#!/usr/bin/env python

import random
import sys

#get sequence length from user input
length = int(sys.argv[1])

#assign any DNA sequence to a string
dnaseq = list('ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT')

#print it
print dnaseq

#assign an empty string to receive the result
result = ''
#loop through the length 
for i in range(length):
    #here we use a random method that randonly picks a position
    #in the list
    result += random.choice(dnaseq)

print result