Generating multiple sets of random DNA sequences with one script (and a bash example) [updated]
Section 4, off topic 3 Comments »A commenter, Dilmurat, gave me an idea about the script that generates random DNA sequence sets. Apparently it wasn’t clear that the script was intended to generate only one sequence set, and not multiple sets. Dilmurat also offered his solution:
#!/usr/bin/env python
import random
import sys
def simulate_sequence(length):
dna = ['A', 'C', 'G', 'T']
sequence = ''
for i in range(length):
sequence += random.choice(dna)
return sequence
setsize = int(sys.argv[1])
minlength = int(sys.argv[2])
maxlength = int(sys.argv[3])
rlength = []
sequenceset = []
for i in range(setsize):
rlength.append(random.randint(minlength, maxlength))
for length in rlength:
sequenceset.append(simulate_sequence(length))
for sequence in sequenceset:
print sequence
I don’t know if the lack of formatting in the comments might have generated a different result to me, but let’s see how we can generate multiple sets of random DNA sequence. Getting back to section 4, we can start with the original script that creates only one set
#!/usr/bin/env python
import random
import sys
def simulate_sequence(length):
dna = ['A', 'C', 'G', 'T']
sequence = ''
for i in range(length):
sequence += random.choice(dna)
return sequence
setsize = int(sys.argv[1])
minlength = int(sys.argv[2])
maxlength = int(sys.argv[3])
sequenceset = []
for i in range(setsize):
rlength = random.randint(minlength, maxlength)
sequenceset.append(simulate_sequence(rlength))
for sequence in sequenceset:
print sequence
There is a very easy way of changing this code to make it output a definite number of sets. WE add a new input parameter and also a loop to it, and that should take care of everything.
#!/usr/bin/env python
import random
import sys
def simulate_sequence(length):
dna = ['A', 'C', 'G', 'T']
sequence = ''
for i in range(length):
sequence += random.choice(dna)
return sequence
setsize = int(sys.argv[1])
minlength = int(sys.argv[2])
maxlength = int(sys.argv[3])
nsets = int(sys.argv[4])
for i in range(nsets):
sequenceset = []
for i in range(setsize):
rlength = random.randint(minlength, maxlength)
sequenceset.append(simulate_sequence(rlength))
for sequence in sequenceset:
print sequence
print
A test with 10 as the number of sequences, 20 as minimum and 30 as maximum length and 2 sets output somthing like this
GCAGATAAACGGGTAAGATGA
ATTAGGAAGGGTCTAAGAGATCCCGGTAA
ATCAGCCTCCGCACGCCTCGTGTA
AGTTTAGCTAGCCGTAGTACTTTC
TTTGAAGCTCGGGGCTAAACTCCGACCAC
GACAGGGTAAGGTGACCTTCTCAG
TGGTTGACTCTGTTCTCTGGT
CGCAATACGTCGTGGTGCCGCTCCACT
TCCTGCAGGGAGGCAGCAGC
TTCGGAGGTATTGAGTACTGTTGCATCG
CCCTTATAATACCTAGTGTAACATTC
TAGTCATGTCATATAACCTGTGTCG
AGCGCGAACCCTCCAGTTTTTTT
AGGGCGTGTAAGCGACGTTGAACAAG
CCATGCGTCTTTTTGGCGATCCGT
ACTCAGATCGGCTAGTATCCTTCGCACG
CTATCGTCGTTCCCAGCAACGGCAGCAGA
CGTGCGATGGGGCGAGATTTTT
ACGCTTTGGCTAGTGGGGAGTTTCGCCACT
what is basically what we need. Quick ‘n’ easy.
Of course a top notch bioinformatician that uses Linux 100% of the time would be able to create a simple bash script and use the initial script to generate multiple random sets. bash is not a primary scope of the blog, but let’s see how to do that. Saying the our initial script was saved as randomset.py we would have a very short script in bash to generate multiple sets. We want to generate 10 sets of sequences of length between 20 and 30 nucleotides, and each set would need to have 10 different sequences (remeber that our initial script only accepts 3 parameters).
Off topic
for ((i=0;i<10;i++))
do
min=20
max=30
nseqs=10
python randomset.py $nseqs $min $max
echo
done
That should do the trick. You can even type it from the command line. The for syntax in bash is very similar to C/C++ but it does not accept spaces, as all the variable assignments. When you assigning a variable value in bash you omit the dollar sign and when you are reading the variable value you access it with the dollar sign, like in the line that runs the script. A for loop in bash starts with a do command and ends in a done command, not brackets or parenthesis involved. The echo at the end helps adding a separating blank line after each random set.
off topic
Of course we could use “makenucseq from the EMBOSS package”, we can even use Dawg from my friend Reed Cartwright, which I believe has a shorter learning curve (and faster compilation) than EMBOSS, but that will be away from the scope of this blog, which is to show how to use Python in simple bioinformatics scripts. I allowed myself to post off topic subjects (including this last paragraph) because a (very) small percentage of the commenter(s) seems to misunderstand the real focus of this tutorial. We don’t need fancy words or complex topics to show how simple things can achieve good results in almost no time. My focus is not give the reader the fish and chips ready to eat. My focus is to show how to fish and peel, cut and fry the potato in order to cook the dish. This way, next time he or she might be cooking better things to eat.
Recent Comments