<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>Beginning Python for Bioinformatics &#187; Section 2</title>
	<atom:link href="http://python.genedrift.org/category/section-2/feed/" rel="self" type="application/rss+xml" />
	<link>http://python.genedrift.org</link>
	<description>a step-by-step guide to create Python applications in bioinformatics</description>
	<lastBuildDate>Thu, 20 May 2010 21:34:41 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.org/?v=3.1-alpha</generator>
		<item>
		<title>Creating an interface for the motif finding script, part 3</title>
		<link>http://python.genedrift.org/2008/10/22/creating-an-interface-for-the-motif-finding-script-part-3/</link>
		<comments>http://python.genedrift.org/2008/10/22/creating-an-interface-for-the-motif-finding-script-part-3/#comments</comments>
		<pubDate>Wed, 22 Oct 2008 20:30:13 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>
		<category><![CDATA[motifs]]></category>
		<category><![CDATA[wxPython]]></category>
		<category><![CDATA[bioinformatics]]></category>
		<category><![CDATA[interface]]></category>
		<category><![CDATA[python]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/?p=178</guid>
		<description><![CDATA[Today we will add some elements to our interface. Looking at the previous screencap it is easy to conclude that our interface needs a lot of work to be ready. First, it has a dark gray background that does not resemble the usual window background (it looks more like a MDI frame). We need to [...]]]></description>
			<content:encoded><![CDATA[<p>Today we will add some elements to our interface. Looking at the previous screencap it is easy to conclude that our interface needs a lot of work to be ready. First, it has a dark gray background that does not resemble the usual window background (it looks more like a MDI frame). We need to change that. Also, there are no menu bars or menus, or tool bars. It&#8217;s pretty bare bones, and not exactly good or useful.</p>
<p>There many ways of customizing the look of a window/frame in wxPython, and two of these methods are adding a panel to the frame or adding the so-called sizers. The latter is a difficult method to master, but powerful and very good to customize objects, look and feels of a window. Addin a panel and subsequently adding objects to it is a more laborious process, but easier to understand. We will start by adding the <a href="http://www.wxpython.org/docs/api/wx.Panel-class.html">panel</a> to you <code>__do_layout</code> function (where most of our changes will happen for now).</p>
<p>Basically, only one line is required:</p>
<pre name="code" class="python">
#adding the panel
panel = wx.Panel(self)
</pre>
<p>That&#8217;s it, the wx.Panel method only needs one parameter, where the panel is being added to. The name <code>panel</code> is the one that we will be using to access methods and properties associated with the wx.Panel derivation that we just created.</p>
<p>Adding the menu would require a little bit more code. As its predecessor wxWidgets, wxPython divides the menu in subcategories. The menubar is based on wx.Menubar method, the menu itself (File, Edit, etc) is a wx.Menu wehre each of the entries is added. At the end each menu derived from wx.Menu will be added to the menubar. In order case we have to initialize a menubar</p>
<pre name="code" class="python">
#defines the menubar
menubar = wx.MenuBar()
</pre>
<p>and then initialize a menu element, which we will call filemenu and will be labeled File</p>
<pre name="code" class="python">
#file menu
filemenu = wx.Menu()
</pre>
<p>This will only initialize a menu element with the name <code>filemenu</code>, it won&#8217;t add anything anywhere. In our case from the start, as we didn&#8217;t do any planning on how our interface would look like (no UML, no case studies, nothing!), we need at least three menu items: one to open/set the foreground sequence file, one to open/set the background sequence file and one to quit the application. So what we are going to do is append these items to the <code>filemenu</code></p>
<pre name="code" class="python">
convertmenu = filemenu.Append(-1, &#039;Select foreground file&#039;)
seqmenu = filemenu.Append(-1, &#039;Select background file&#039;)
sep = filemenu.AppendSeparator()
treenooutmenu = filemenu.Append(-1, &#039;Quit&#039;)
</pre>
<p>that simple. The first two lines and the last one append the items that open/set files. The -1 parameter is an ID, as we saw previously, when no ID is required for our code we use -1, and the second parameter is the label of that menu item. The menu item <code>sep</code> is a separator, keeping apart the file open/set items and the quit element. One final thing is append the derived wx.Menu to the menubar and set it. We accomplish that by </p>
<pre name="code" class="python">
#appends the menu to the menubar and creates it
menubar.Append(filemenu, &#039;File&#039;)
self.SetMenuBar(menubar)
</pre>
<p>Line 2 initializes menubar on self, also known as pymotGUI, our main window. Putting everything together our code would look like</p>
<pre name="code" class="python">
#!/usr/bin/env python

import wx
import pymot
import fasta

class pymot(wx.App):

    def __init__(self, redirect=False):
        wx.App.__init__(self, redirect)

class pymotGUI(wx.Frame):

    def __init__(self, parent, id):

        wx.Frame.__init__(self, parent, id,  &#039;Python Motif Finder&#039;, style=wx.DEFAULT_FRAME_STYLE)
        self.__do_layout()
#        self.__do_binding()

    def __do_layout(self):

        #adding the panel
        panel = wx.Panel(self)

        #defines the menubar
        menubar = wx.MenuBar()

        #file menu
        filemenu = wx.Menu()
        foreground_menu = filemenu.Append(-1, &#039;Select foreground file&#039;)
        background_menu = filemenu.Append(-1, &#039;Select background file&#039;)
        sep = filemenu.AppendSeparator()
        quit_menu = filemenu.Append(-1, &#039;Quit&#039;)

        #appends the menu to the menubar and creates it
        menubar.Append(filemenu, &#039;File&#039;)
        self.SetMenuBar(menubar)

#if __name__ == &#039;__main__&#039;:
app = pymot()
frame = pymotGUI(parent=None, id = -1)
#frame.CentreOnScreen()
frame.Show()
app.MainLoop()
</pre>
<p>and this would look like the screencap below (on Vista).</p>
<p><a href="http://python.genedrift.org/wordpress/wp-content/uploads/2008/10/gui2.png"><img src="http://python.genedrift.org/wordpress/wp-content/uploads/2008/10/gui2-150x150.png" alt="gui2" title="gui2" width="150" height="150" class="aligncenter size-thumbnail wp-image-179" /></a></p>
<p>Next time we will work on more elements and activate the menu items.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2008/10/22/creating-an-interface-for-the-motif-finding-script-part-3/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
		</item>
		<item>
		<title>Section 2: a nice summary script</title>
		<link>http://python.genedrift.org/2007/03/14/section-2-a-nice-summary-script/</link>
		<comments>http://python.genedrift.org/2007/03/14/section-2-a-nice-summary-script/#comments</comments>
		<pubDate>Wed, 14 Mar 2007 20:32:24 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/03/14/section-2-a-nice-summary-script/</guid>
		<description><![CDATA[Closing section two, let&#8217;s use everything we saw before and write a nice script that will read a sequence file (DNA) and report us of any &#8220;errors&#8221; and the number of different nucleotides. It is very simple, but a good exercise. Depending on your needs you can easily modify it to check for other characteristics [...]]]></description>
			<content:encoded><![CDATA[<p>Closing section two, let&#8217;s use everything we saw before and write a nice script that will read a sequence file (DNA) and report us of any &#8220;errors&#8221; and the number of different nucleotides. It is very simple, but a good exercise. Depending on your needs you can easily modify it to check for other characteristics of sequences, even change it to read amino acids sequences. We start with the code, comments coming after it.</p>
<pre name="code" class="python">
#!/usr/bin/env python

import sys
import re

fileentered = True
while fileentered == True:
    filename = raw_input(&#039;Please enter a file to check: &#039;)
    if len(filename) &gt;= 1:
        try:
            seqlist = open(filename, &#039;r&#039;).readlines()
	    sequence = &#039;&#039;.join(seqlist)
	    sequence = sequence.replace(&#039;\n&#039;, &#039;&#039;)
            totalA = sequence.count(&#039;A&#039;)
            totalC = sequence.count(&#039;C&#039;)
            totalG = sequence.count(&#039;G&#039;)
            totalT = sequence.count(&#039;T&#039;)
            otherletter = re.compile(&#039;[BDEFHIJKLMNOPQRSUVXZ]&#039;)
	    extra = re.findall(otherletter, sequence)
	    output = open(filename+&#039;.count&#039;, &#039;w&#039;)
	    output.write(&#039;Count report for file &#039; + filename + &#039;\n&#039;)
	    output.write(&#039;A = &#039; + str(totalA) + &#039;\n&#039;)
	    output.write(&#039;C = &#039; + str(totalC) + &#039;\n&#039;)
	    output.write(&#039;G = &#039; + str(totalG) + &#039;\n&#039;)
	    output.write(&#039;T = &#039; + str(totalT) + &#039;\n&#039;)
	    if len(extra) &gt; 0:
	    	output.write(&#039;Also were found &#039; + str(len(extra)) + &#039; errors\n&#039;)
	    	for i in extra:
		    output.write(i + &#039; &#039;)
	    else:
		output.write(&#039;No error found&#039;)
            output.close()
	    print &#039;Result file saved on &#039; + filename + &#039;.count&#039;
        except:
            print &#039;File not found. Please try again.&#039;
    else:
        sys.exit()
</pre>
<p>The main change here is that we use a <code>while</code> loop to control de program flow. Notice that we import <code>sys</code> and <code>re</code>. Basically we ask for an user input, the filename, and depending on the input given we process the file or exit the program. The early exit is done with the <code>sys.exit</code> method which is a shortcut to get out of the script processing. Very handy. If the input is valid we <code>try</code> to open it. If the operation is successful, great, we read the file, count the nucleotides and use a quite scary regular expression to search all the &#8220;errors&#8221; in our sequence. </p>
<p>The regex is compiled with the pattern <code>'[BDEFHIJKLMNOPQRSUVXZ]'</code> which means &#8220;match any character in this range&#8221;. Take a closer look at the pattern and you will see that is every letter in the alphabet, except for ACGT. And when searching for these &#8220;errors&#8221; instead of using <code>re.search</code> we use <code>re.findall</code>, which conveniently returns a list with all the substrings found. That&#8217;s even more handy. </p>
<p>On the final part of the script we take care of the output, opening a file called <code><whatever>.count</code> where we print the counts and the errors, if they actually exist. One thing I left from the previous post, is that we need to close the file opened to write. In some cases if the file is not properly closed, errors might occur. So always remember to close the files used for writing/appending, using <code><filename>.close()</code>.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/03/14/section-2-a-nice-summary-script/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Writing to files</title>
		<link>http://python.genedrift.org/2007/03/13/writing-to-files/</link>
		<comments>http://python.genedrift.org/2007/03/13/writing-to-files/#comments</comments>
		<pubDate>Tue, 13 Mar 2007 19:58:58 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/03/13/writing-to-files/</guid>
		<description><![CDATA[We already know how to read from files, now we are going to see how to write to them. We will start with a simple example, writing some content to a &#8220;fresh&#8221; file that does not exist in the system. Sometime ago, we have seen the print statement in Python, that prints to the system [...]]]></description>
			<content:encoded><![CDATA[<p>We already know how to read from files, now we are going to see how to write to them. We will start with a simple example, writing some content to a &#8220;fresh&#8221; file that does not exist in the system. </p>
<p>Sometime ago, we have seen the <code>print</code> statement in Python, that prints to the system standard output (usually the screen). This output can be redirected using <code>></code> to a stream/file. But if we are going to create really professional applications (even to our own use), usually stream redirection is not really the nicest approach. In some cases the best alternative is to save a file.</p>
<p>Also, some posts ago, we covered the methodology to <code>open</code> a file. We are going to use here the same command, <code>open</code> to (in our case) create the file. Remember that to read the file we used</p>
<pre name="code" class="python">
file = open(dnafile, &#039;r&#039;)
</pre>
<p>where the <code>'r'</code> is the mode we are using to open the file. In that case we used the <em>read</em> mode, now we are going to use the <em>write</em> mode. When we open a file with this command in <em>write</em> mode if the file (with the name with pass) does not exist it is created. If it does exist, all the contents of the current file will be erased, so be careful when opening a file from your script. Check for the location, file name, etc before opening the file.</p>
<p>So, basically we have</p>
<pre name="code" class="python">
file = open(output, &#039;w&#039;)
</pre>
<p>and the file is open and ready to receive data.</p>
<p>Let&#8217;s cheat and use the previous script that counts nucleotides and modify it to save a <code>count.txt</code> file wit the results:</p>
<pre name="code" class="python">
#!/usr/bin/env python

#let&#039;s keep the file fixed for now
dnafile = &quot;AY162388.seq&quot;
#opening the file, reading the sequence and storing in a list
file = open(dnafile, &#039;r&#039;)
#initialize a string to receive the data
sequence = &#039;&#039;
for line in file:
    sequence += line.strip() #notice the strip, to remove n
#&quot;exploding&quot; the sequence in a list
seqlist = list(sequence)
#initializing integers to store the counts
totalA = 0
totalC = 0
totalG = 0
totalT = 0
#checking each item in the list and updating counts
for base in seqlist:
    if base == &#039;A&#039;:
        totalA += 1
    elif base == &#039;C&#039;:
        totalC += 1
    elif base == &#039;G&#039;:
        totalG += 1
    elif base == &#039;T&#039;:
        totalT += 1
#printing results
resultfile = open(&#039;counts.txt&#039;, &#039;w&#039;)
resultfile.write(str(totalA) + &#039; As found \n&#039;)
resultfile.write(str(totalC) + &#039; Cs found \n&#039;)
resultfile.write(str(totalG) + &#039; Gs found \n&#039;)
resultfile.write(str(totalT) + &#039; Ts found \n&#039;)
</pre>
<p>The only difference is at the end of the script. Here instead of <code>print</code> we use <code>write</code>. Notice that <code>write</code> is a method of the opened file.(in our case called <code>resultfile</code>. This method only accepts strings, so we need to convert everything to string before writing in the file. Notice also that we need to add a carriage return/newline at the end of the string to be written. Differently of <code>print</code>, <code>write</code> does not automatically puts a new line at the end of the output.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/03/13/writing-to-files/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
		</item>
		<item>
		<title>Manipulating strings: again</title>
		<link>http://python.genedrift.org/2007/03/13/manipulating-strings-again/</link>
		<comments>http://python.genedrift.org/2007/03/13/manipulating-strings-again/#comments</comments>
		<pubDate>Tue, 13 Mar 2007 19:30:54 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/03/13/manipulating-strings-again/</guid>
		<description><![CDATA[As I have not updated the website in a couple of weeks, I will try to catch up with the book instead of revisiting (for the time being) our past scripts. I am going to finish the book&#8217;s chapter 5 (our section 2) in the next post, where I will give a small introduction on [...]]]></description>
			<content:encoded><![CDATA[<p>As I have not updated the website in a couple of weeks, I will try to catch up with the book instead of revisiting (for the time being) our past scripts. I am going to finish the book&#8217;s chapter 5 (our section 2) in the next post, where I will give a small introduction on how to output data to a file in Python. On this post we will check some of the methods that can be used to manipulate strings. The book gives only a couple of methods to be used in perl on string, but here I will show a longer list of Python methods that can be used on its immutable strings.</p>
<p>A full list of the methods can be found <a href="http://docs.python.org/lib/string-methods.html">here</a> and I will will give brief explanations on the ones I think are key for bioinformatics. Remember that string cannot be changed in Python, so we will always going to use a buffer/temp variable to store our changed string when needed.</p>
<p>- <strong>count</strong> this method returns the number of times you see a substring (a letter/number, a word, etc) in another string. You can also specify a start and an end positions to look for. This is handy if you are counting nucleotides/aaminoacids in a sequence. This method returns an integer</p>
<p>- <strong>endswith</strong> this method checks the end of your string for a determined substring. Very handy of you need to check the tail end of your sequence right away.</p>
<p>- <strong>find</strong> returns the position of the substring being searched, and -1 if it is not found. It is similar to the re.search we used before. This is very useful if you are looking for a determined motif/subsequence in a hurry.</p>
<p>- <strong>islower</strong> returns a true bool (true or false) if all characters in the string are lowercase. False if at least one of the characters is uppercase. Very handy if you need to convert lowercase to UPPERCASE files for input in some application. Works in conjunction with the <strong>isupper</strong> which is basically the opposite.</p>
<p>- <strong>join</strong>. We have seen this before: it concatenates strings using a determined separator.</p>
<p>- <strong>lower</strong> and <strong>upper</strong>, that as their name might indicate return the string converted to lowercase/uppercase. This is also good for the conversion of sequence format in input files.</p>
<p>I will stop here. There are many other methods that can be used. Some of the above were already covered here and in the next posts we will take a look at the other ones, creating an application that actually performs some useful function.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/03/13/manipulating-strings-again/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Counting nucleotides: part II</title>
		<link>http://python.genedrift.org/2007/02/22/counting-nucleotides-part-ii/</link>
		<comments>http://python.genedrift.org/2007/02/22/counting-nucleotides-part-ii/#comments</comments>
		<pubDate>Thu, 22 Feb 2007 19:51:58 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/22/counting-nucleotides-part-ii/</guid>
		<description><![CDATA[Let&#8217;s check the &#8220;short&#8221; way, that is basically a method that avoid the &#8220;explosion&#8221; of the string. Instead of transforming the sequence from the file from a string to a list, we go and use the string directly, applying one of the methods available to manipulate strings. This time we read the file at once [...]]]></description>
			<content:encoded><![CDATA[<p>Let&#8217;s check the &#8220;short&#8221; way, that is basically a method that avoid the &#8220;explosion&#8221; of the string. Instead of transforming the sequence from the file from a string to a list, we go and use the string directly, applying one of the methods available to manipulate strings. This time we read the file at once and convert the list to a string using <code>join</code>. To count we simply use the method <code>count</code> on our string. Pretty nice.</p>
<pre name="code" class="python">
#!/usr/bin/env python
#still keep the file fixed
dnafile = &quot;AY162388.seq&quot;
#opening the file, reading the sequence and storing in a list
seqlist = open(dnafile, &#039;r&#039;).readlines()
#let&#039;s join the the lines in a temporary string
temp = &#039;&#039;.join(seqlist)
#counting
totalA = temp.count(&#039;A&#039;)
totalC = temp.count(&#039;C&#039;)
totalG = temp.count(&#039;G&#039;)
totalT = temp.count(&#039;T&#039;)
#printing results
print str(totalA) + &#039; As found&#039;
print str(totalC) + &#039; Cs found&#039;
print str(totalG) + &#039; Gs found&#039;
print str(totalT) + &#039; Ts found&#039;
</pre>
<p>That&#8217;s the short way: using <code>count</code>. This is a method that when applied on a string counts the number of times the substring appears in our string. We can even set a start and ending point to count. Notice one difference in this script to the previous examples: after we join the items of the list into a string we do not remove the carriage returns. Because in this case we don&#8217;t need it, as it will be an extra character there that won&#8217;t make any harm.<br />
Download the above code from the <a href="http://python.genedrift.org/repository/">repository</a>.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/22/counting-nucleotides-part-ii/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Counting nucleotides</title>
		<link>http://python.genedrift.org/2007/02/22/counting-nucleotides/</link>
		<comments>http://python.genedrift.org/2007/02/22/counting-nucleotides/#comments</comments>
		<pubDate>Thu, 22 Feb 2007 19:48:35 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/22/counting-nucleotides/</guid>
		<description><![CDATA[We are going to jump the regular expression explanation that you can find in the book, and we will go directly to the section that introduces string/list/array manipulation and adapt it to Python. We are going to see two different methods: a &#8220;long&#8221; and a &#8220;short&#8221; one. In many places and computer languages you will [...]]]></description>
			<content:encoded><![CDATA[<p>We are going to jump the regular expression explanation that you can find in the book, and we will go directly to the section that introduces string/list/array manipulation and adapt it to Python.</p>
<p>We are going to see two different methods: a &#8220;long&#8221; and a &#8220;short&#8221; one. In many places and computer languages you will see that there are different ways of doing the same thing, with advantages and disadvantages. It is up to you to define which methods are better or worse, as this is a very personal matter. Some people prefer the longer way because it might be clearer and easier to understand, or it might be necessary to use it due to code maintainability. Other people would rather use the shorter path because they want to generate code faster.</p>
<p>It does not matter the path you select, as long as you get your task done. That&#8217;s the key: focus on the end product not on how exactly got there. If you used 10 lines of code more, or 10 less, that&#8217;s irrelevant as long as you did what you wanted. Live and learn and someday you will use the even shorter way.</p>
<p>So we start with the long way. We want to count the individual number of nucleotides in a sequence, determining they relative frequency. Remember that we read the lines of a sequence file into a list, using <code>readlines</code>. But on the long method we will read the file and store the data into a string like</p>
<pre name="code" class="python">
file = open(filename, &#039;r&#039;)
sequence = &#039;&#039;
for line in file
    sequence += line
</pre>
<p>This way it will be easier to &#8220;explode&#8221; the sequence in separated items. After the &#8220;explosion&#8221; we can check each item in the list and get our result. The code is below, I will be back after it.</p>
<pre name="code" class="python">
#!/usr/bin/env python
#let&#039;s keep the file fixed for now
dnafile = &quot;AY162388.seq&quot;
#opening the file, reading the sequence and storing in a list
file = open(dnafile, &#039;r&#039;)
#initialize a string to receive the data
sequence = &#039;&#039;
for line in file:
    sequence += line.strip() #notice the strip, to remove \n
#&quot;exploding&quot; the sequence in a list
seqlist = list(sequence)
#initializing integers to store the counts
totalA = 0
totalC = 0
totalG = 0
totalT = 0
#checking each item in the list and updating counts
for base in seqlist:
    if base == &#039;A&#039;:
        totalA += 1
    elif base == &#039;C&#039;:
        totalC += 1
    elif base == &#039;G&#039;:
        totalG += 1
    elif base == &#039;T&#039;:
        totalT += 1
#printing results
print str(totalA) + &#039; As found&#039;
print str(totalC) + &#039; Cs found&#039;
print str(totalG) + &#039; Gs found&#039;
print str(totalT) + &#039; Ts found&#039;
</pre>
<p>Most of the above code was already covered before. Let&#8217;s look at the different stuff, like the &#8220;explosion line&#8221;</p>
<pre name="code" class="python">
seqlist = list(sequence)
</pre>
<p>Here we basically transform our string <code>sequence</code> into a list, by putting the object type we want before the object we want converted, like we do here</p>
<pre name="code" class="python">
print str(totalA) + &#039; As found&#039;
</pre>
<p>This construction <code>type_to_convert(to_be_converted)</code> tells Python to get whatever is inside the parentheses and transform into whatever is outside. Converting the string to a list will get</p>
<pre name="code" class="python">
GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGT
GCGAAGGTAGCGTAATCACTTGTTCTTTAAATAAGGACTAGTATG
AATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATCAGTGAA
...
</pre>
<p>and transform it into</p>
<pre name="code" class="python">
[&#039;G&#039;, &#039;T&#039;, &#039;G&#039;, &#039;A&#039;, &#039;C&#039;, &#039;T&#039;, &#039;T&#039;, &#039;T&#039;, &#039;G&#039;, &#039;T&#039;, &#039;T&#039;, &#039;C&#039;, &#039;A&#039;, &#039;A&#039;, &#039;C&#039;, &#039;G&#039;, &#039;G&#039;, &#039;C&#039;, &#039;C&#039;, &#039;G&#039;, &#039;C&#039;, &#039;G&#039;,
 &#039;G&#039;, &#039;T&#039;, &#039;A&#039;, &#039;T&#039;, &#039;C&#039;, &#039;C&#039;, &#039;T&#039;, &#039;A&#039;, &#039;A&#039;, &#039;C&#039;, &#039;C&#039;, &#039;G&#039;, &#039;T&#039;, &#039;G&#039;, &#039;C&#039;, &#039;G&#039;, &#039;A&#039;, &#039;A&#039;, &#039;G&#039;, &#039;G&#039;, &#039;T&#039;, &#039;A&#039;, &#039;G&#039;, &#039;C&#039;, &#039;G&#039;, &#039;T&#039;,
&#039;A&#039;, &#039;A&#039;, &#039;T&#039;, &#039;C&#039;, &#039;A&#039;, &#039;C&#039;, &#039;T&#039;, &#039;T&#039;, &#039;G&#039;, &#039;T&#039;, &#039;T&#039;, &#039;C&#039;, &#039;T&#039;, &#039;T&#039;, &#039;T&#039;, &#039;A&#039;, &#039;A&#039;, &#039;A&#039;, &#039;T&#039;, &#039;A&#039;, &#039;A&#039;, &#039;G&#039;, &#039;G&#039;, &#039;A&#039;, &#039;C&#039;, &#039;T&#039;, &#039;A&#039;,
 &#039;G&#039;, &#039;T&#039;, &#039;A&#039;, &#039;T&#039;, &#039;G&#039;, &#039;A&#039;, &#039;A&#039;, &#039;T&#039;, &#039;G&#039;, &#039;G&#039;, &#039;C&#039;, &#039;A&#039;, &#039;T&#039;,...]
</pre>
<p>After &#8220;exploding&#8221;, we use a <code>for</code> loop to iterate over every item in the list and use conditional statements to do the counts. Regarding the counts, we use this operator </p>
<pre name="code" class="python">
totalT += 1
</pre>
<p>that, in C/C++, tells the interpreter to get the value of <code>totalT</code> and add 1 to it. </p>
<p>On the next post, we will see the short way and further modify the above script, that can be downloaded from the <a href="http://python.genedrift.org/repository/">repository</a>.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/22/counting-nucleotides/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Commenting in Python</title>
		<link>http://python.genedrift.org/2007/02/22/commenting-in-python/</link>
		<comments>http://python.genedrift.org/2007/02/22/commenting-in-python/#comments</comments>
		<pubDate>Thu, 22 Feb 2007 19:46:24 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/22/commenting-in-python/</guid>
		<description><![CDATA[As you might have noticed from the previous posts, comments in Python are defined mainly by the # sign. This is the signal used for single line comment like #this is a single line comment If you are used to C++, this would be equivalent to //. On the other hand, multi line comments are [...]]]></description>
			<content:encoded><![CDATA[<p>As you might have noticed from the previous posts, comments in Python are defined mainly by the <code>#</code> sign. This is the signal used for single line comment like</p>
<pre name="code" class="python">
#this is a single line comment
</pre>
<p>If you are used to C++, this would be equivalent to <code>//</code>.</p>
<p>On the other hand, multi line comments are defined by triple double quotes <code>"""</code>, opening and closing, similar to C++ <code>/* ... */</code>, like this</p>
<pre name="code" class="python">
&quot;&quot;&quot;this is a multi
line comment&quot;&quot;&quot;
</pre>
<p>Just a note. Resuming bioinformatics mode.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/22/commenting-in-python/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Finding motifs in DNA sequences: twist</title>
		<link>http://python.genedrift.org/2007/02/20/finding-motifs-in-dna-sequences-twist/</link>
		<comments>http://python.genedrift.org/2007/02/20/finding-motifs-in-dna-sequences-twist/#comments</comments>
		<pubDate>Tue, 20 Feb 2007 19:30:10 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/20/finding-motifs-in-dna-sequences-twist/</guid>
		<description><![CDATA[As promised, let&#8217;s change a bit our previous code, and make it more effective. If you are reading this tutorial in one-entry mode, let&#8217;s check the code #!/usr/bin/env python import re dnafile = &#34;AY162388.seq&#34; seqlist = open(dnafile, &#039;r&#039;).readlines() temp = &#039;&#039;.join(seqlist) sequence = temp.replace(&#039;\n&#039;, &#039;&#039;) inputfromuser = True while inputfromuser: inmotif = raw_input(&#039;Enter motif to [...]]]></description>
			<content:encoded><![CDATA[<p>As promised, let&#8217;s change a bit our previous code, and make it more effective. If you are reading this tutorial in one-entry mode, let&#8217;s check the code</p>
<pre name="code" class="python">
#!/usr/bin/env python
import re
dnafile = &quot;AY162388.seq&quot;
seqlist = open(dnafile, &#039;r&#039;).readlines()
temp = &#039;&#039;.join(seqlist)
sequence = temp.replace(&#039;\n&#039;, &#039;&#039;)
inputfromuser = True
while inputfromuser:
    inmotif = raw_input(&#039;Enter motif to search: &#039;)
    if len(inmotif) &gt;= 1:
        motif = re.compile(&#039;%s&#039; % inmotif)
        if re.search(motif, sequence):
            print &#039;Yep, I found it&#039;
        else:
            print &#039;Sorry, try another one&#039;
    else:
        print &#039;Done, thanks for using motif_search&#039;
        inputfromuser = False
</pre>
<p>In order to make it more effective, let&#8217;s allow the input of any file, maybe asking for the file as soon as the script is started. To accomplish that we need to &#8220;protect&#8221; the script and make it error proof (almost at least). Yes, you thought it right: we need to check if the input file exists before opening it.</p>
<p>We can use <code>try ... except</code> statements to do that. Pretty handy. This is called an exception handler, so basically we try the validity of some command/method and depending on the result we continue our program flow or we catch the exception and do something else. Under <code>try</code> we put the expression to evaluate, and under <code>excepts</code> what to do in case of failure. Like this</p>
<pre name="code" class="python">
try:
    opening a file
except:
    as the file does not exist, print something
</pre>
<p>So, let&#8217;s put in our code above. We remove this</p>
<pre name="code" class="python">
dnafile = &quot;AY162388.seq&quot;
seqlist = open(dnafile, &#039;r&#039;).readlines()
</pre>
<p>and include this lines</p>
<pre name="code" class="python">
fileinput = True
while fileinput == True:
    filename = raw_input(&#039;Enter file name:&#039;)
    if len(filename) &gt; 0:
        try:
            dnafile = open(filename, &#039;r&#039;)
            fileinput = False
        except:
            print &#039;File does not exist, please try again&#039;
    else:
        sys.exit()
</pre>
<p>I know, a lot of new code. But if you take a closer look, there is only three lines we have never seen: <code>try except</code> and the last line with <code>sys.exit()</code>. Here, the script tries to open the file provided as input, if it does find the file normal operation resumes, if does not, the script asks for another input. As in the other while loop, we control it with a boolean variable, and in the case of empty input we end the loop and the script, using a system command <code>exit</code>, in the last line of the new code.</p>
<p>Our script is better now, not bulletproof, but a little bit more efficient. There still a &#8220;flaw&#8221;, that you can only check one file for each run of the script. At least we not stuck to our usual DNA sequence. </p>
<p>Download the commented code on the <a href="http://python.genedrift.org/repository/">repository</a>.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/20/finding-motifs-in-dna-sequences-twist/feed/</wfw:commentRss>
		<slash:comments>6</slash:comments>
		</item>
		<item>
		<title>Finding motifs in DNA sequences</title>
		<link>http://python.genedrift.org/2007/02/14/finding-motifs-in-dna-sequences/</link>
		<comments>http://python.genedrift.org/2007/02/14/finding-motifs-in-dna-sequences/#comments</comments>
		<pubDate>Wed, 14 Feb 2007 19:26:26 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/14/finding-motifs-in-dna-sequences/</guid>
		<description><![CDATA[As you might have noticed, BPB generally uses protein sequences. I am a &#8220;DNA guy&#8221;, and basically in our simple examples either type of sequence (except the example on transcribing) could have been used. I will stick with this molecule for a while, or until I can. We are going to use our good old [...]]]></description>
			<content:encoded><![CDATA[<p>As you might have noticed, BPB generally uses protein sequences. I am a &#8220;DNA guy&#8221;, and basically in our simple examples either type of sequence (except the example on transcribing) could have been used. I will stick with this molecule for a while, or until I can.</p>
<p>We are going to use our good old AY162388.seq file, still assigning the file name inside the script there will be a twist in the end. Also, remember the Regular Expression module? We are going to use it too. I am going to do just as the book: I will paste the code below with comments in the middle and explain it afterwards.</p>
<pre name="code" class="python">
#!/usr/bin/env python
#finding motifs in DNA sequences
# we use the RegEx module
import re
#still keep the file fixed
dnafile = &quot;AY162388.seq&quot;
#opening the file, reading the sequence and storing in a list
seqlist = open(dnafile, &#039;r&#039;).readlines()
#let&#039;s join the the lines in a temporary string
temp = &#039;&#039;.join(seqlist)
#assigning our sequence, with no carriage returns to our
#final variable/object
sequence = temp.replace(&#039;\n&#039;, &#039;&#039;)
#we start to deal with user input
#first we use a boolean variable to check for valid input
inputfromuser = True
#while loop: while there is an motif larger than 0
#the loop continues
while inputfromuser:
    #raw_input received the user input as string
    inmotif = raw_input(&#039;Enter motif to search: &#039;)
    #now we check for the size of the input
    if len(inmotif) &gt;= 1:
        #we compile a regex with the input given
        motif = re.compile(&#039;%s&#039; % inmotif)
        #looking to see if the entered motif is in the sequence
        if re.search(motif, sequence):
            print &#039;Yep, I found it&#039;
        else:
            print &#039;Sorry, try another one&#039;
    else:
        print &#039;Done, thanks for using motif_search&#039;
        inputfromuser = False
</pre>
<p>Now let&#8217;s dissect the code, in a biological way. We already seen everything up to the part the list&#8217;s lines are joined. First new lines for us is this</p>
<pre name="code" class="python">
sequence = temp.replace(&#039;\n&#039;, &#039;&#039;)
</pre>
<p>Most of the methods in Python have very intuitive names (ok, most languages do), so it is easy to deduce that <code>replace</code> actually replaces something. And why do we need to use this method? First, we joined the lines in one temporary string (yep, strings are immutable), but the lines come with everything, including carriage returns that we need to get rid of. So our &#8220;final&#8221; string <code>sequence</code> receives the value in <code>temp</code> and we apply the method <code>replace</code> to modify it. <code>replace</code> has two arguments, the first is the string we want to change from, while the second is the string we want to replace with (in fact <code>replace</code> accepts three arguments, the last being the number of times we want to do the change). In our case, we are telling the interpreter to get every substring <code>'\n'</code> and put an empty one in their places.</p>
<p>The next line is a simple value assignment:</p>
<pre name="code" class="python">
inputfromuser = True
</pre>
<p>and the variable will manage the <code>while</code> that checks input from the user. Basically we will run the loop until a certain type of input is given, that will make the variable value become <code>False</code>. That&#8217;s why we have the line</p>
<pre name="code" class="python">
while inputfromuser
</pre>
<p>with no check. Yep, notice that we don&#8217;t need to check for the variable&#8217;s value, Python assumes that it is True. To understand better, imagine that <code>inputfromuser</code> is a flag that appears when True and disappears when False. Python can only &#8220;see&#8221; it when it appears, and when it does disappear it needs to check for it. We will elaborate more later.</p>
<p>Another different line awaits us</p>
<pre name="code" class="python">
inmotif = raw_input(&#039;Enter motif to search: &#039;)
</pre>
<p><code>raw_input</code> is a function that takes a line input by the user and returns a string. In  our case, we assign the value returned by the function to a new string called <code>inmotif</code>. Also, <code>raw_input</code> has one <i>prompt</i> argument which is written to the screen with no trailing line, waiting for the user to input something. This takes us to the <code>while</code> loop</p>
<pre name="code" class="python">
if len(inmotif) &gt;= 1:
        #we compile a regex with the input given
        motif = re.compile(r&#039;%s&#039; % inmotif)
        #looking to see if the entered motif is in the sequence
        if re.search(motif, sequence):
            print &#039;Yep, I found it&#039;
        else:
            print &#039;Sorry, try another one&#039;
    else:
        print &#039;Done, thanks for using motif_search&#039;
        inputfromuser = False
</pre>
<p>After getting the input from the user, we need to check the size of such input: if it is greater or equal to one, we will search it in our sequence, otherwise we will finish the loop. So if we get a valid input (valid in the sense of size, for now)  we will compile the regex and search for it.</p>
<p>There is a difference in regex compilation. In the DNA transcribing we assigned a string to the regex directly, now we have a string coming from a variable/object</p>
<pre name="code" class="python">
motif = re.compile(r&#039;%s&#039; % inmotif)
</pre>
<p>Notice the difference in the argument that is passed to the <code>compile</code> function. In this case the regex to be compiled is coming from the string entered by the user, and we have to pass it by using Python&#8217;s string formatting operator, noted as a <code>%</code>. This formatting operator uses two parameters: a string with formatting characters and the data to be formatted, separated by the percent sign. In our case the formatting character will receive a string, hence the <code>%s</code> (s for string), and the data to be formatted that is the input.</p>
<p>Previously, we used the regex function to replace characters/substrings in a sequence. This time, we are interested to know if the motif entered by the user is in our sequence. So we use the search method instead</p>
<pre name="code" class="python">
if re.search(motif, sequence):
</pre>
<p>Notice that we do the search in at the same time we are testing for its result. The same case as the checking we do at the while loop. If there is a positive result from the regex search a True flag will be raised and the interpreter will execute the code of the initial branch, not testing for the <code>elif</code> and <code>else</code></p>
<pre name="code" class="python">
print &#039;Yep, I found it&#039;
        else:
            print &#039;Sorry, try another one&#039;
</pre>
<p>This condition is nested inside another condition, the one that tests for the size of the input entered. So, if our search returns a regex object, we print <code>Yep, I found it</code>, otherwise the user will receive <code>Sorry, try another one</code>. Now back to our upper <code>if</code>, if the user input length is equal to zero (just pressing the Enter key) the interpreter will process the line</p>
<pre name="code" class="python">
print &#039;Done, thanks for using motif_search&#039;
</pre>
<p>and then </p>
<pre name="code" class="python">
inputfromuser = False
</pre>
<p>that will tell the while loop that there is no True variable anymore, ending the loop and consequently our script. </p>
<p>Let&#8217;s review the script and its flow:</p>
<pre name="code" class="python">
1) assign a filename to be opened
2) read the file
3) join the lines
4) remove carriage returns
5) ask for user input, while is valid
6) if input length is greater or equal to 1, process it
     6a) compile regex with input
     6b) search for it
          6b1) if it is found print yes
          6b2) if it is not found print no
7) if input length is equal to zero, end while loop,
end string
</pre>
<p>I know it is a lot of information, take your time. The code can be downloaded from the <a href="http://python.genedrift.org/repository/">repository</a>. Next I will change a bit this script using other methods to find the motifs, and making the promised twist in the method that reads the file.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/14/finding-motifs-in-dna-sequences/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Flow control in Python</title>
		<link>http://python.genedrift.org/2007/02/13/flow-control-in-python/</link>
		<comments>http://python.genedrift.org/2007/02/13/flow-control-in-python/#comments</comments>
		<pubDate>Tue, 13 Feb 2007 19:24:35 +0000</pubDate>
		<dc:creator>Paulo Nuin</dc:creator>
				<category><![CDATA[Section 2]]></category>

		<guid isPermaLink="false">http://python.genedrift.org/2007/02/13/flow-control-in-python/</guid>
		<description><![CDATA[We start following the fifth chapter of BPB. The first item is about flow control and code layout, which are very relevant for our tutorial. We already introduced briefly both aspects in past entries on the site, but it is always good to check. As the book, I will start with flow control. Flow control [...]]]></description>
			<content:encoded><![CDATA[<p>We start following the fifth chapter of BPB. The first item is about flow control and code layout, which are very relevant for our tutorial. We already introduced briefly both aspects in past entries on the site, but it is always good to check. As the book, I will start with flow control.</p>
<p><strong>Flow control</strong> is the way your instructions are executed by the program. Most languages have a linear flow control, meaning every line is executed from top to bottom. This linear flow control can be disrupted by two types of statements: looping and branching. Looping statements tell the computer to execute a determined set of commands until certain condition is met. This can be a numeric value (ie from 1 to 100) or the number of items in a list (like our shop list from before). Branching statements are also known as conditional statements, tell the computer to execute/or not determined lines depending on certain conditions.</p>
<p>The <code>for</code> loop was shown before. In its for loop Python iterates over the elements in a list like this</p>
<pre name="code" class="python">
for lines in text:
    &lt;i&gt;do something&lt;/i&gt;
</pre>
<p>Notice that the first line of the loop ends in a colon. This and the word <code>for</code> in the line> tell the interpreter that this a for loop and the <strong>indented</strong> block below is the code to be executed repeatedly until the last element in the list is reached. How Python knows where the loop ends? Indentation. Many languages use curly braces, parentheses, etc. In Python the loop ends by checking the indentation level of lines (this will help us a lot when discussing code layout).</p>
<p>We&#8217;ve already seen one example of loop in Python, <code>for</code>, but Python accepts other types of loop structures, such as <code>while</code>, that uses the same indented properties to execute the commands.</p>
<p>[sourcecode]mycounter = 0<br />
while mycounter == 0:<br />
    do something[/sourcecode]</p>
<p>Take a closer look at the <code>while</code> line. See something different? Maybe not, if you are used to programming. In Python equality is tested with a double equal sign (<code>==</code>), while a sole equal sign (<code>=</code>) assigns a value to a variable. You can also test for inequality, greater and less than, with <code>!=</code>, <code><</code> and <code>></code> respectively.</p>
<blockquote><p>Attention: is quite common to generate errors by substituting <code>==</code> by <code>=</code>, so pay attention when coding.</p></blockquote>
<p>Branching statements are the conditional commands in a computer language, usually governed by <code>if ... then ... else</code>. In Python a branching statement would look like</p>
<pre name="code" class="python">
if value == 1:
    do something
elif value == 2:
    do something else
else:
    do even more
</pre>
<p>Notice the colon ending each line of the conditions and again the indented code, telling the interpreter where the corresponding code for each condition ends.</p>
<p>We are going to use a lot of conditions and loops, but as you might have noticed Python has some tricks that make us avoid these statements. </p>
<p>About <strong>code layout</strong> just one word: indentation. No brackets, parentheses, curly braces, etc. Yes, we have seen brackets and parentheses, but not to tell the interpreter where loops and conditions start and end. This is taken care by indentation, making our life easier and the code more beautiful.</p>
<p>Next we will see Python's ability to find motifs in words, mainly on DNA sequences.</p>
]]></content:encoded>
			<wfw:commentRss>http://python.genedrift.org/2007/02/13/flow-control-in-python/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
	</channel>
</rss>

