Yes, Python 3.0 was released earlier than Perl … what version was it? 6? 7? Anyway, I decided to go back to most of the scripts that were posted here. In the github repo we have 50 files in the “original scripts” directory. Let’s check how do they fare on Python 3.0 and what type of changes we need to do in order to make them work. Starting with code_01.py, which is a couple of lines long

myDNA = "ACGTACGTACGTACGTACGTACGT"
print myDNA

Here we have one of the most evident differences between Python 2.x and 3.0. Now print is a function not a statement anymore, so whatever we want to print now should be passed as a function parameter. The above code would be changed to 

myDNA = "ACGTACGTACGTACGTACGTACGT"
print(myDNA)

That simple ins this case. But what are the advantages of print being a function over a statement? More flexibility, as can be seen in the link above. It is possible now to send different parameters to print and make the output richer by customizing separators between items, directing the output, etc.

A similar change would have to be made n our code_02.py. There are two print statements there that should be translated to the function. Trivial, so far. The original code

myDNA = "ACGTACGTACGTACGTACGTACGT"
myDNA2 = "TCGATCGATCGATCGATCGA"
print "First and Second sequences"
print myDNA, myDNA2
myDNA3 = myDNA + myDNA2
print "Concatenated sequence"
print myDNA3

and to work on Python 3

myDNA = "ACGTACGTACGTACGTACGTACGT"
myDNA2 = "TCGATCGATCGATCGATCGA"
print("First and Second sequences")
print(myDNA, myDNA2)
myDNA3 = myDNA + myDNA2
print("Concatenated sequence")
print(myDNA3)

This is would be the biggest (or at least the most common) change that we would need to make in the scripts posted here. Follow the repo to get the newer versions.