There is a reason to say that Python has batteries included. On the last post we have seen a small example of randomization in Python, generating random integer values for a (extremely) simple dice game. We move to another example, still simple which will allow us to generate random DNA sequences. The script is

#!/usr/bin/env python

import random
import sys

length = int(sys.argv[1])

dnaseq = list('ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT')

result = ''
for i in range(length):
    result += random.choice(dnaseq)

print result

Not fancy at all, just plain simple (yet again). We import a couple of modules, sys and random, and ask for the sequence length as a script parameter. dnaseq is a list containing a tandem repeat of ACGT, and from there we will extract our random nucleotides. In fact dnaseq could have been ‘ACGT’ only. The fact that we create a string and convert it to a list, is just for convenience of writing 'ACGT...' easier than ['A', 'C' ...]. We then declare an empty string that will be used to store the random sequence. And inside the loop, the command that does all the magic: random.choice(<list>). This command will return a random element from the list passed as subject. Using it inside a loop we will get a random nucleotide on each iteration and add it to our string.

This is a very simple command, but at the same time extremely powerful and easy to implement. A good exercise from this would be to modify the dnaseq string and see if there is any change in the final random sequence.