Reading files in Python
Section 1 January 30th, 2007We are currently following Chapter 4 of Beginning Perl for Bioinformatics, which is the first chapter of the book that actually has code snippets and real programming. The last exercises in this chapter deal with the ability to read files and operate with information extracted from these files, to create arrays and scalar list in perl.
We are going to check how to read files in python. The book tells you how to read protein sequences. Here we are going to read DNA and protein sequences from files and change them.
Let say you have a file with a DNA sequence in some directory in your hard disk. The file cannot be a FASTA type (we will see later how to handle FASTA files), just pure sequence, something like this:
GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGTAATCACTTGTTC
TTTAAATAAGGACTAGTATGAATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATC
AGTGAAACTAATCTCCCGTGAAGAAGCGGGAATTAACTTATAAGACGAGAAGACCCTATG
GAGCTTTAAACCAAATAACATTTGCTATTTTACAACATTCAGATATCTAATCTTTATAGC
ACTATGATTACAAGTTTTAGGTTGGGGTGACCGCGGAGTAAAAATTAACCTCCACATTGA
AGGAATTTCTAAGCAAAAAGCTACAACTTTAAGCATCAACAAATTGACACTTATTGACCC
AATATTTTGATCAACGAACCATTACCCTAGGGATAACAGCGCAATCCATTATGAGAGCTA
TTATCGACAAGTGGGCTTACGACCTCGATGTTGGATCAGGG
You can download the file here. This is a partial sequence of a mitochondrial gene from a South American frog species called Hylodes ornatus. For our purposes you can save the file in the same directory you are going to run the script from, or if you are using the Python interpreter start it in the directory that contains the file.
The file name is not important but we will use AY162388.seq from now on. The first thing we have to do is to open the file for reading. We define a string variable that will contain the file name.
dnafile = "AY162388.seq"
In order to open the file, we can use the command open, that receives two strings: the first is the file name (it can be the whole location too) to be opened and the mode to be used, which is what you want to do with the file. The mode can be one or more letters that tell the interpreter what to do. For now we are going to use the r mode , which tells Python to read the file, and only do that. So our code is
file = open(dnafile, 'r')
file is a file object that contains the directives to read our DNA sequence file. Now, we have actually read the contents of the file but they are stored in a file object and we did not accessed it yet. We can achieve that by using a myriad of commands. We will start with the commonest one: read the file line by line.
file is our file object. We have just opened it, but Python already knows that any file contains lines (remember that this is a regular ASCII file). We are going to use a loop to read each line of the file, one by one
for line in file:
print line
In Python, the for loop/statement iterates over items in a sequence of items, usually a string or a list (we will see Python’s list soon), instead of iterating over a progression of numbers. Basically, our for above will iterate over each line in the file until EOF (end-of-file) is reached. Our simple script to read a DNA sequence from a file and output to the screen is
#! /usr/bin/env python
dnafile = "AY162388.seq"
file = open(dnafile, 'r')
for line in file:
print line
You can download the above script here. To run it have the AY162388.seq in the same directory.
Recent Comments